View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18661_high_22 (Length: 230)
Name: NF18661_high_22
Description: NF18661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18661_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 167
Target Start/End: Complemental strand, 12701137 - 12700987
Alignment:
| Q |
18 |
ataaccaccctctatattgatataaaaccactctctatattgatataaggaaggtacaacttgttggaagatctaatttaaattgaacttctagcaagtg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12701137 |
ataaccactctctatattgatataaaaccactctctatattgatataaggaagctacaacttgttggaagatctaatttaaattgaacttctagcaagtg |
12701038 |
T |
 |
| Q |
118 |
tgc-ctcttttgcttctcttcaactttaacaaaacgtgaatgacactaagt |
167 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12701037 |
tgctctcttttgcttctcttcaactttaacaaaacgtgaatgacattaagt |
12700987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 162 - 214
Target Start/End: Complemental strand, 12699557 - 12699505
Alignment:
| Q |
162 |
ctaagtttatgttgtttcagaatcagttatctaaagataaagaggcccatatt |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12699557 |
ctaagtttatggtgtttcagaatcagttatctaaagataaagaggcccatatt |
12699505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University