View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18661_low_11 (Length: 335)
Name: NF18661_low_11
Description: NF18661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18661_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 177 - 324
Target Start/End: Complemental strand, 4419298 - 4419150
Alignment:
| Q |
177 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattccnnnnnnnnnn-gtgggatactagttgtaaaaataagatgatgttttt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4419298 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattcctttttttttttgtgggatactagttataaaaataagatgatgttttt |
4419199 |
T |
|
| Q |
276 |
ggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419198 |
ggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
4419150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 4419465 - 4419378
Alignment:
| Q |
18 |
gtatttgtatttgtacattgtattggaatatttcgaaaacatgcataattatattggatcactacaaagagatacaataatcacacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419465 |
gtatttgtatttgtacattgtattggaatatttcgaaaacatgcataattatattggatcactacaaagagatacaataatcacacaa |
4419378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University