View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18661_low_20 (Length: 239)

Name: NF18661_low_20
Description: NF18661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18661_low_20
NF18661_low_20
[»] chr7 (1 HSPs)
chr7 (21-136)||(10684028-10684143)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 10684143 - 10684028
Alignment:
21 ataaagatactatttttattaatatatttttcttgagaactgagtctttgcacttttatgaatgtttctgggggttttcaattgaccactgatcttatat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10684143 ataaagatactatttttattaatatatttttcttgagaactgagtctttgcacttttatgaatgtttctgggggttttcaattgaccactgatcttatat 10684044  T
121 tttgtggggtctcatg 136  Q
    ||||||||||||||||    
10684043 tttgtggggtctcatg 10684028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University