View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18662_high_16 (Length: 259)
Name: NF18662_high_16
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18662_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 53 - 136
Target Start/End: Original strand, 13294756 - 13294839
Alignment:
| Q |
53 |
taccattttgtatgacttttacatcttcaacataaaaagactagaaaaggcttcacaaagaagatggagagaaatcgaacatat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13294756 |
taccattttgtatgacttttacatcttcaacataaaaaaactagaaaaggcttcacaaagaagatggagagaaatcgaacatat |
13294839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 13294839 - 13294908
Alignment:
| Q |
165 |
tacaactgcaatatggtgttgcaattatagatacttatagatttagagagaaaccgttagagttctcacc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13294839 |
tacaactgcaatatggtgttgcaattatagatacttatagatttagagagaaaccgttagagttctcacc |
13294908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University