View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18662_high_8 (Length: 318)
Name: NF18662_high_8
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18662_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 61 - 110
Target Start/End: Complemental strand, 11135299 - 11135250
Alignment:
| Q |
61 |
ctgtcagacacatatgcaatcgtgtccgtgtgtatgcgtgtcagtgtcga |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11135299 |
ctgtcagacacatatgcaatcgtgtcagtgtgtatgcatgtcagtgtcga |
11135250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 64
Target Start/End: Complemental strand, 11135783 - 11135753
Alignment:
| Q |
34 |
aaaataatcagttttagaaaattcaatctgt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11135783 |
aaaataatcagttttagaaaattcaatctgt |
11135753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University