View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18662_low_10 (Length: 318)

Name: NF18662_low_10
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18662_low_10
NF18662_low_10
[»] chr4 (2 HSPs)
chr4 (61-110)||(11135250-11135299)
chr4 (34-64)||(11135753-11135783)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 61 - 110
Target Start/End: Complemental strand, 11135299 - 11135250
Alignment:
61 ctgtcagacacatatgcaatcgtgtccgtgtgtatgcgtgtcagtgtcga 110  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||||    
11135299 ctgtcagacacatatgcaatcgtgtcagtgtgtatgcatgtcagtgtcga 11135250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 64
Target Start/End: Complemental strand, 11135783 - 11135753
Alignment:
34 aaaataatcagttttagaaaattcaatctgt 64  Q
    |||||||||||||||||||||||||||||||    
11135783 aaaataatcagttttagaaaattcaatctgt 11135753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University