View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18662_low_16 (Length: 275)
Name: NF18662_low_16
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18662_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 263
Target Start/End: Original strand, 40046044 - 40046303
Alignment:
| Q |
5 |
tgttgagtctatctctttatttggtaaggatattaagatggctcatcattgaagattgaatcagtggagctattttagttttatttactatttttgcttg |
104 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40046044 |
tgttgtgtatatctctttatttggtaaggatattaagatggctcatcattgaagattgaatcagtggagctattttagttttatttactatttttgcttg |
40046143 |
T |
|
| Q |
105 |
tgagtgtactccatttagggaaaatagagtgggaggtcaatttgatgtaggggtgagatgataaaatatgagttagatagatgcatgcatgtgttgcttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40046144 |
tgagtgtactccatttagggaaaatagagtgggaggtcaatttgatgtaggggtgagatgataaaatatgagttagatagatgcatgcatgtgttgcttt |
40046243 |
T |
|
| Q |
205 |
tatttaaaagtttataaatcattctaaaattcaatta-ttttaaagttctttttgatatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
40046244 |
tatttaaaagtttataaatcattctaaaattcaattacttttaaagttctttttaatatt |
40046303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University