View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18662_low_19 (Length: 260)
Name: NF18662_low_19
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18662_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 147 - 248
Target Start/End: Original strand, 906791 - 906892
Alignment:
| Q |
147 |
aaaacgagtctcatcttcaaatttgtataataaaagagtgagtgttgggaactcgagaacttttgccatatcattttcggtttaaactttatctttaata |
246 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
906791 |
aaaactagtctcatcttcaaatttgtataataaaagagtgagtgttgggaactcgagaacttttgcaatatcattttcagtttaaactttatctttaata |
906890 |
T |
 |
| Q |
247 |
tt |
248 |
Q |
| |
|
|| |
|
|
| T |
906891 |
tt |
906892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 906626 - 906769
Alignment:
| Q |
14 |
acaactatgtcaagcacttccagtcagtatgtgcttaacagaatattggtgaaatttttgcaagttttgtgaatttttcttttgaaatgttaatttggaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| || ||| ||| |
|
|
| T |
906626 |
acaactatgtcaagcacttccagtcagtatgtgcttaacagaatattggtgaaatttttgcaagttttgtgaatt----ttttgtaatttttcttttgaa |
906721 |
T |
 |
| Q |
114 |
gtggtgattgccttctacacccttaccccttccaaaacgagtctcatctt |
163 |
Q |
| |
|
|| | ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
906722 |
atgttaatt--tatctacacccttaccccttccaaaacgagtctcatctt |
906769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University