View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18662_low_5 (Length: 435)
Name: NF18662_low_5
Description: NF18662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18662_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 98 - 227
Target Start/End: Complemental strand, 33492721 - 33492592
Alignment:
| Q |
98 |
atttttattgatgatgtttatcgtctaagtttaaagtggcaaattattaaatttataacttgtccaacgaacgctacaaaatttatgcgattcgtttata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33492721 |
atttttattgatgatgtttatcgtctaagtttaaagtggcaaattattaaatttataacttgtccaacgaacgctacaaaatttatgcgattagtttata |
33492622 |
T |
|
| Q |
198 |
atttttgttaagaacctgttattttagatg |
227 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
33492621 |
atttttgttaagaacctgttactttagatg |
33492592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 319 - 424
Target Start/End: Complemental strand, 33797946 - 33797838
Alignment:
| Q |
319 |
atattcatcatcacatgacacacattgattctgatagtcacatttaatagatga---aaatgagagagaattatgtatgtagttggtggtgttt-ttggt |
414 |
Q |
| |
|
|||||||||||||||||||| ||| |||| | | ||||| ||||||||||||| |||||||||||||| ||||| ||||||| |||||| ||||| |
|
|
| T |
33797946 |
atattcatcatcacatgacatgcat-gattataagagtcatatttaatagatgatgaaaatgagagagaatcatgtacgtagttgacagtgtttcttggt |
33797848 |
T |
|
| Q |
415 |
gatagatatg |
424 |
Q |
| |
|
|||||||||| |
|
|
| T |
33797847 |
gatagatatg |
33797838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University