View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18663_low_5 (Length: 239)
Name: NF18663_low_5
Description: NF18663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18663_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 20527534 - 20527746
Alignment:
| Q |
9 |
ggtttattccatgtgtatcttgtgcttagaatagagttttcacctcaatgacgcaatgctctctaggaataattttggatttgtgtttcatatcagccaa |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| | |||||| |||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20527534 |
ggtttattccatgagtatcttgtgcttagaatagagttttcaccttagtgacgccttgctgtctaggaatgattttggatttgtgtttcatatcagccaa |
20527633 |
T |
 |
| Q |
109 |
agcatcttttgagttcaacattacaacgatctaacataattacaaaacattgacacagtcttttatagttccctaaacaatttaatcctattaatgaaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
20527634 |
agcatcttttgagttcaacattacaacaatctaacataattacaaaacattgacacagtcttttatagttccttaaacaatttcatcctattaatgaaca |
20527733 |
T |
 |
| Q |
209 |
tctttgagtcacc |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20527734 |
tctttgagtcacc |
20527746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University