View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_high_40 (Length: 246)
Name: NF18664_high_40
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 58 - 232
Target Start/End: Original strand, 40376025 - 40376199
Alignment:
| Q |
58 |
cttgtgatgagggtggctccgatggccggacggtggtggtgggagtgaaaatggattcaccaagcaaagagcttcttacttgggctttggttaaagttgc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376025 |
cttgtgatgagggtggctccgatggccggacggtggtggtgggagtgaaaatggattcaccaagcaaagagcttcttacttgggctttggttaaagttgc |
40376124 |
T |
 |
| Q |
158 |
tcaacctggtgatcttgtagttgctctgcatgttcttgggactaatggtgagtgatgattttcatttgtttttat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40376125 |
tcaacctggtgatcttgtagttgctctgcatgttcttgggactaatggtgagtgataattttcatttgtttttat |
40376199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 40375968 - 40376005
Alignment:
| Q |
1 |
catcatagtactttatctctgatcgtgatcatctgaag |
38 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
40375968 |
catcatagtactttgtctctgatcatgatcatctgaag |
40376005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 10257616 - 10257668
Alignment:
| Q |
142 |
ctttggttaaagttgctcaacctggtgatcttgtagttgctctgcatgttctt |
194 |
Q |
| |
|
||||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
10257616 |
ctttggtcaatgttgctcaacctggtgatcttattcttgctcttcatgttctt |
10257668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University