View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_30 (Length: 315)
Name: NF18664_low_30
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 297
Target Start/End: Complemental strand, 34670719 - 34670433
Alignment:
| Q |
10 |
aagaaaattgtagctcatatcatgaatgatagtttgtcacatatcacaaaggttgaatgaagaannnnnnnggaagttggaaacttagaatcacatgtag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
34670719 |
aagaaaattgtagctcatatcatgaatgatattttgtcatatatcacaaaggtttaatgaagaatttttttggaa-ttggaaacttagaatcacatgtag |
34670621 |
T |
 |
| Q |
110 |
atgaaatattataagtcagttgaggtttcatttacctttccaccatgagggatgatgccacgcaactctttaagacagtcttggatctgctgccgatctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34670620 |
atgaaatattataagtcagttgaggtttcatttacctttccaccatgagggatgatgccacgcaactctttaagacagtcttgaatctgctgccgatctt |
34670521 |
T |
 |
| Q |
210 |
ttggtcgtggccgagtgctctcccccggcttagccttcttcttgttgggctttgcgggctcgtccagttttctagggtgtaccggaac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34670520 |
ttggtcgtggccgagtgctctcccccggcttagccttcttcttgttgggctttgcgggctcgtccagttttctagggtgtaccggaac |
34670433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University