View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_35 (Length: 285)
Name: NF18664_low_35
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 38446866 - 38446740
Alignment:
| Q |
18 |
caaactaacgattaactgtctgtgaatgacataagacaatatagttggattaacgggtttcgttctcnnnnnnnnacataatatgcacgtttgatatgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38446866 |
caaactaacgattaactgtctgtgaatgacgtaagacaatatagttggattaacgggtttcgttctctttcttttacataatatgcacgtttgatatgca |
38446767 |
T |
|
| Q |
118 |
aacttttatttaagaattgtttgaata |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38446766 |
aacttttatttaagaattgtttgaata |
38446740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University