View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_49 (Length: 245)
Name: NF18664_low_49
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 33562520 - 33562746
Alignment:
| Q |
1 |
ttagagactaatttgacatttatgatttccaaaaaatttatgtaaatatacaaccattattgaagtatggtgattgatttaaggcttctccattgtacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33562520 |
ttagagactaatttgacatttatgatttccaaaaattttatgtaaatatacaaccattattgaagtatggtgattgatttaaggcttctccattgtacct |
33562619 |
T |
 |
| Q |
101 |
ttcggaaatcgctccaccaaaatggcgaggagcattaggcacagggtttaannnnnnnatgcaaattggcgttgtggctgcggggttcataaactttgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33562620 |
ttcggaaatcgctccaccaaaatggcgaggagcattaggcacagggtttaatttttttatgcaagttggcgttgtggctgcggggttcataaactttgtc |
33562719 |
T |
 |
| Q |
201 |
gctgcaaaacacccttggggatggcga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33562720 |
gctgcaaaacacccttggggatggcga |
33562746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 130
Target Start/End: Original strand, 33627208 - 33627257
Alignment:
| Q |
81 |
aaggcttctccattgtacctttcggaaatcgctccaccaaaatggcgagg |
130 |
Q |
| |
|
|||||| | ||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
33627208 |
aaggctgcaccattgtacctatctgaaattgctccaccaaaatggcgagg |
33627257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University