View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_52 (Length: 238)
Name: NF18664_low_52
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 13447497 - 13447707
Alignment:
| Q |
11 |
gcacagattgtagatgattgaaaaccagacatgaaagaaatgcattcgaaccaaacttggtatgtatagcgaatgaaacaaattaggggctaatcttcgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447497 |
gcacagattgtagatgattgaaaaccagacatgaaagaaatgcattcgaaccaaacttggtatgtatagcgaatgaaacaaattaggggctaatcttcgg |
13447596 |
T |
|
| Q |
111 |
tcnnnnnnnnnnnnnnnngacaggatcccacaaaatctagagatttaaagtacagaaaccagctttacaggattcttccatttcattcgactgtaaacaa |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447597 |
tcaaaagaaaaagaaacagacaggatcccacaaaatctagagatttaaagtacaggaaccagctttacaggattcttccatttcattcgactgtaaacaa |
13447696 |
T |
|
| Q |
211 |
cagcaatgtca |
221 |
Q |
| |
|
| ||||||||| |
|
|
| T |
13447697 |
cggcaatgtca |
13447707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University