View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_53 (Length: 237)
Name: NF18664_low_53
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 5400511 - 5400719
Alignment:
| Q |
13 |
ataatactaggataggattttgggtaaaaacaattttgatatctaaatgtgtgaaggattgtccttatatatcaaaattgttaacatattctcaagtgtc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5400511 |
ataatactaggataggattttgggtaaaaacaattttgatatctaaatgtgtgaaggattgtcgttatatatcaaaattgttaacatattctcaagtgtc |
5400610 |
T |
 |
| Q |
113 |
tttttagttagtcattttgctcttcttacaagtcaatttagtcataaaatgtgtttttcgtaagtcaatttaaactataaattacaaacaagatataaac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5400611 |
cttttagttagtcattttgctcttcttacaagtcaatttagtcataaaatatgtttttcgtaagtcaatttaaactataaattacaaacaagatataaac |
5400710 |
T |
 |
| Q |
213 |
cgaaggtat |
221 |
Q |
| |
|
||||||| |
|
|
| T |
5400711 |
ttaaggtat |
5400719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University