View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_54 (Length: 235)
Name: NF18664_low_54
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 8317488 - 8317284
Alignment:
| Q |
15 |
cttacctcaatattcaagtccaacccctcaattttgatagatttcacgtggtgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317488 |
cttacctcaatattcaagtccaacccctcaattttgatagatttcacgcgatgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcag |
8317389 |
T |
|
| Q |
115 |
gaaaacttggcttacaaatgatttcagctgaatcaaaagacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317388 |
gaaaacttggcttacaaatgatttcagctgaatcaaaagacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaa |
8317289 |
T |
|
| Q |
215 |
ttgct |
219 |
Q |
| |
|
||||| |
|
|
| T |
8317288 |
ttgct |
8317284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University