View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_55 (Length: 219)
Name: NF18664_low_55
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_55 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 37084082 - 37084300
Alignment:
| Q |
1 |
actagcttgctactttaggttcatcgaagtaatcgactttgttgagcttatattatgaatatattgcaacatcaactacatactaagcataattgtaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37084082 |
actagcttgctactttaggttcatcgaagtaatcgactttgttgagcttatattatgaatatattgcaacatcaactacatactaagcataattgtaaat |
37084181 |
T |
|
| Q |
101 |
ctaattttcttaaattttgcacgtttttactctggagtcgttgttgggaacaaaaattcaaaaccagaactagttaaaccaaaatatgatctcgagaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37084182 |
ctaattttcttaaattttgcacgtttttactctggagtcgttgttgggaacaaaaattcaaaaccagaactagttaaaccaaaatatgatctcgagaaca |
37084281 |
T |
|
| Q |
201 |
aaatcaaaataaatcagat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37084282 |
aaatcaaaataaatcagat |
37084300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University