View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18664_low_56 (Length: 206)
Name: NF18664_low_56
Description: NF18664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18664_low_56 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 33634754 - 33634549
Alignment:
| Q |
1 |
ttctatgacctattttccctcgtgcttacttatatttttgtgtatcaattagtttatcattacttattattagtagaaaatattgtcnnnnnnnntagta |
100 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33634754 |
ttctatgacctattttccctcatgtttacttatatttttgtgtatcaattagtttgtcattacttattattagtagaaaatattgtcaaaaaaaatagta |
33634655 |
T |
 |
| Q |
101 |
gaaaattgaggcgtgttaagattgtgttgttttggtgtgttttgtatttgtagcaaatttattaggtggatctcaaagtgtgttcattttctagcttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33634654 |
gaaaattgaggcgtgttaagattgtgttgttttggtgtgttttgtatttgtagcaaatttattaggtggatctcaaagtgtgtttattttctagcttatt |
33634555 |
T |
 |
| Q |
201 |
ttgatt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33634554 |
ttgatt |
33634549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University