View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18665_low_19 (Length: 259)
Name: NF18665_low_19
Description: NF18665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18665_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 9723075 - 9723319
Alignment:
| Q |
1 |
aaagtttgatgaacatttattgatcgtacatttnnnnnnn-caaacatactactattgtaatcctacgtcttatctttcaaacatgcacttaattagagt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9723075 |
aaagtttgatgaacatttattgatcgtacatttaaaaaaaacaaacatactactattgtaatcctacgtcttatctttcaaacatgcagttaattagagt |
9723174 |
T |
 |
| Q |
100 |
gaagcatagacatttcacaaaaagtgacatctctaagattaatcttcctttcatatggagagatttaatcatagtttttggctccttctccacattcctt |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9723175 |
aaagcatagacatttcaccaaaagtgacatctctaagattaatcttcctttcatatggagagatttaatcatagtttttggctccttctccacattcctt |
9723274 |
T |
 |
| Q |
200 |
aaagaaacttatcttgaatctaggttctaattaggttctaattaa |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9723275 |
aaagaagcttatcttgaatctaggttctaattaggttctaattaa |
9723319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University