View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18665_low_7 (Length: 425)
Name: NF18665_low_7
Description: NF18665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18665_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 19 - 419
Target Start/End: Original strand, 45143854 - 45144254
Alignment:
| Q |
19 |
agtgttcccctgtttctgtttattcaccatcttacagcttccgttacatcgaaaacaaggcaagaatctcatatcaccacaaccctcacatacacctcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143854 |
agtgttcccctgtttctgtttattcaccatcttacagcttccgttacatcgaaaacaaggcaagaatctcatatcaccacaaccctcacatacacctcct |
45143953 |
T |
|
| Q |
119 |
ccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccgatataatatccct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143954 |
ccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccgatataatatccct |
45144053 |
T |
|
| Q |
219 |
tcacaaacactctcggcggaatcaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcacgctcgcatatttg |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144054 |
tcacaaacactctcggcggaaccaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcacgctcgcatatttg |
45144153 |
T |
|
| Q |
319 |
tacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcaccactttcttctct |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144154 |
tacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcaccactttcttctct |
45144253 |
T |
|
| Q |
419 |
c |
419 |
Q |
| |
|
| |
|
|
| T |
45144254 |
c |
45144254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University