View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18666_high_1 (Length: 408)
Name: NF18666_high_1
Description: NF18666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18666_high_1 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 150225 - 149988
Alignment:
| Q |
12 |
ttccgatctcttgttcagttcttgaagatgtttctgagcttgtttggtattgttctttccatgctcttgctaaccatagcatttcattaggtttccaaac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150225 |
ttcccatctcttgttcagttcttgaagatgtttctgagcttgtttggtattgttctttccatgctcttgctaaccatagcatttcattaggtttccaaac |
150126 |
T |
 |
| Q |
112 |
aggacttacatatttcccttttcttagttgttgatgaacttgttggtctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150125 |
aggacttacatatttcccttttcttagttgttgatgaacttgttgttctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatga |
150026 |
T |
 |
| Q |
212 |
gattgtgatgaagttgtctctgatgaagaagcagctaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150025 |
gattgtgatgaagttgtctctgatgaagaagcagctaa |
149988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University