View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18666_high_2 (Length: 396)
Name: NF18666_high_2
Description: NF18666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18666_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Complemental strand, 1660923 - 1660535
Alignment:
| Q |
1 |
tatgatattgtaaatatgaaaagggtcaacaccccttggttgcattgcatgaatttttgcctggtggaaggaagccaagtcaaaatctcataaaggtata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1660923 |
tatgatattgtaaatatgaaaagggtcaacaccccttggttgcattgcatgaatttttgcctggtggaaggaagccaagtcaaaatctcataaaggtata |
1660824 |
T |
 |
| Q |
101 |
gaaaaaggaaaaggaaaatgtggtgcaatgagttaacgcatggtcaacatcatcacaataatcagcattcatcatgccacgagtttacacgcgttaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1660823 |
gaaaaaggaaaaggaaaatgtggtgcaatgagttaacgcatggtcaacatcatcacaataatcagcattcatcatgccacgagtttacacgcgttaaaat |
1660724 |
T |
 |
| Q |
201 |
agtcataaaagtattattactatcaaggattctccaagcacatgtaaatgtcccctcacatgattaacacgggaacttacttcccttcccctgcaatgtc |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1660723 |
agtcat-aaagtattattactatcaaggattctccaagcacatgtaaatgtcccctcacatgattaacacgggaacttacttcccttcccctgcaatgtc |
1660625 |
T |
 |
| Q |
301 |
tcaattgggttcacagggaaaatgaaactagtgtatctttatatcacttagtaaataattcaatgacttctttttatctggttcatctca |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1660624 |
tcaattgggttcacagggaaaatgaaactagtgtatctttatatcacttagtaaataattcaatgacttctttttatctggttcagctca |
1660535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University