View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18667_high_8 (Length: 243)
Name: NF18667_high_8
Description: NF18667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18667_high_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 40094611 - 40094377
Alignment:
| Q |
9 |
aacctgtgacatgccaggatacatcatgtatgttttcttttctttctttgcggagtctggtaacaaacattcatagttggtcacgttacnnnnnnncaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
40094611 |
aacctgtgacatgccaggatacatcatgtatgttttcttttctttctttgcggagtctggtaacaaacattcatagttggtcatgttacaaaaaaacaat |
40094512 |
T |
|
| Q |
109 |
attgcaaacattattactcgagaaatgtgatctgcgaaattattgcatattctacaaaagatagaagaaaagaaatgtttttacccagtgactaccgaag |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40094511 |
attgcaaacattattattcgagaaatgtgatctgcgaaattattgcatattctacaaaagatagaagaaaagaaatgtttttacccagtgactaccgaag |
40094412 |
T |
|
| Q |
209 |
acaatttgtcgggtggtttcaagttttctaatgtg |
243 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
40094411 |
acaatttgtcgggtggcttcaagttttctaatgtg |
40094377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University