View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18667_high_9 (Length: 234)
Name: NF18667_high_9
Description: NF18667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18667_high_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 234
Target Start/End: Complemental strand, 13722518 - 13722314
Alignment:
| Q |
30 |
atatgatatgagcaattgaactttgttattcaagaactaagatgaacacaccttgccacaaaaagcaatatatttagaaaacaacttcttgattctctct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13722518 |
atatgatatgagcaattgaactttgttattcaagaactaagatgaacacaccttgccacaaaaagcaatatatttagaaaacaacttcttgattctctct |
13722419 |
T |
 |
| Q |
130 |
ttctcatctttccttaaagcttctagtttctcatcattcaaagatcttgctggaagtttcccaactacaacaacacaaatacacaatcacaaaactaagc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13722418 |
ttctcatctttccttaaagcttctagtttctcatcattcaaagatcttgctggaagtttcccaactacaacaacacaaatacacaatcacaaaactaaac |
13722319 |
T |
 |
| Q |
230 |
taaac |
234 |
Q |
| |
|
||||| |
|
|
| T |
13722318 |
taaac |
13722314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University