View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18667_low_11 (Length: 246)
Name: NF18667_low_11
Description: NF18667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18667_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 47992107 - 47991936
Alignment:
| Q |
12 |
gaaaatcagaaagttattgaaaaaacaaaatctatgagtgaaagggtattttatatgaaagcgtcaagagcctgctaattgctacctatgagctttttgg |
111 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47992107 |
gaaaatcaaaaagttattgtgaaaacaaaatctatgagtgaaagggtattttatatgaaagcgttaagagcctgctaattgctacctatgagctttttgg |
47992008 |
T |
|
| Q |
112 |
aagaaactgctacaattgttgtgtacttgattagcatatgttcatcctcagatatagggttcaaggaacatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47992007 |
aagaaactgctacaattgttgtgtacttgattagcatatgttcatcctcagatatagggttcaagaaacatg |
47991936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 47991816 - 47991772
Alignment:
| Q |
186 |
gtgtccattctaagttctaactaacccttatgatacgacaacatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47991816 |
gtgtccattctaagttctaactaacccttatgatacgacaacatt |
47991772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University