View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18667_low_14 (Length: 224)
Name: NF18667_low_14
Description: NF18667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18667_low_14 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 11270 - 11053
Alignment:
| Q |
1 |
ccgaggttgtttatctacgagtgtcctatggtgaaacaattagaacaacaataatacaatctttcgtagacgatatatcaacataaaatgcaaaaccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11270 |
ccgaggttgtttatctacgagtgtcctatggtgaaacaattagaccaacaataatacaatctttcgtagacgatat--caacataaaatgcaaaaccttc |
11173 |
T |
|
| Q |
101 |
gcacatcaccaacacttcatcaaatattctctaggatatgtcaatgtcgacaagaatgccagcgtagtacctaccctgcttgatatttcaaacaatgttc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11172 |
gcgcatcaccaacacttcatcaaatattctctaggataggtcaatgtcgacaagaatgccagcgtagtacctaccccgcttgatatttcaaacaatgttc |
11073 |
T |
|
| Q |
201 |
ttggcagccaatattcttgg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11072 |
ttggcagccaatattcttgg |
11053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University