View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18667_low_7 (Length: 371)
Name: NF18667_low_7
Description: NF18667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18667_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 13 - 353
Target Start/End: Complemental strand, 40094224 - 40093884
Alignment:
| Q |
13 |
gaaatgaagaatatgacaccaaagtggatgcgttttcttttgctctgatattacaagaggtaaatatctaaatctataccgttactgctcacatgtgcat |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| | ||||||||||||||||| |
|
|
| T |
40094224 |
gaaatgaggaatatgacaccaaagtggatgcgttttcttttgctctgatattacaagaggtaaaaatctaaatctttaccatcactgctcacatgtgcat |
40094125 |
T |
|
| Q |
113 |
gcatgttttaatactctggagctttctaataattttcaagctgatcatttacctataatatgtaagtagtcgtttcttctctggtcttgatataaggctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40094124 |
gcatgttttaatactctggagctttctaataattttcaagctgatcatttacctataatatgcaagtagtcgtttcttgtctggtcttgatataaggctt |
40094025 |
T |
|
| Q |
213 |
atacaccctaacctttcnnnnnnnnnnnnnnnnnnnnnnnnngtttgatgaatcgatggttctgatgaagactgattaatgtggtatttgacaaaataat |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40094024 |
atacaccctaacctttcaaatataataaaaaatagaaaaatagtttgatgaatcgatggttctgatgaagactgattaatgtggtatttgacaaaataat |
40093925 |
T |
|
| Q |
313 |
acatgctaattgaatttattcttttgttatttactcctctg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40093924 |
acatgctaattgaatttattcttttgttatttactcctctg |
40093884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University