View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_high_33 (Length: 262)
Name: NF18668_high_33
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 35036399 - 35036156
Alignment:
| Q |
1 |
ctaagaatatattatggcattaggtttattagaaatagagattgtaaaaggttgtttatagaaaggataaataaaatgaaaacgccatgaacatgtatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036399 |
ctaagaatatattatggcattaggtttattagaaatagagattgtaaaaggttgtttatagaaaggataaataaaatgaaaacgccatgaacatgtatct |
35036300 |
T |
 |
| Q |
101 |
tggaattcattgtatattatgtcttatgagagtcgaatcatgttttcattgcacacttgcatttatataggaataaattgtaatgtcctctctagaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036299 |
tggaattcattgtatattatgtcttatgagagtcgaatcatgttttcattgcacacttgcatttatataggaataaattgtaatgtcctctctagaggat |
35036200 |
T |
 |
| Q |
201 |
agtaattctagcaatctccgatttgtatccgccagatacaaaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036199 |
agtaattctagcaatctccgatttgtatccgccagatacaaaat |
35036156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University