View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_high_38 (Length: 240)
Name: NF18668_high_38
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 18 - 171
Target Start/End: Complemental strand, 43739196 - 43739043
Alignment:
| Q |
18 |
ataactactaaatatattctgtcagaaaaagattactgatatgcattagacataattttgtcnnnnnnnnnntgtattagacttaattgcattgttggtc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43739196 |
ataactactaaatatattctgtcagaaaaagattactaatatgcattagacataattttgtcaacaaaaaaaattattagacttaattgcattgttggtc |
43739097 |
T |
 |
| Q |
118 |
ccctaagttttagaattgtacgatctttcaaatttacaccattttataccattt |
171 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43739096 |
ccctaagttttagaattgtacgatctctcaaatttacaccattttataccattt |
43739043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 209 - 240
Target Start/End: Complemental strand, 43738995 - 43738964
Alignment:
| Q |
209 |
tcaagcatgcacgatattttgagttgactcca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43738995 |
tcaagcatgcacgatattttgagttgactcca |
43738964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University