View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_high_9 (Length: 427)
Name: NF18668_high_9
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 23 - 412
Target Start/End: Original strand, 8883683 - 8884071
Alignment:
| Q |
23 |
ctacgtatgattattactctttacagataaaaaataactagaaaataccaaaatcatataactttgtaagaatattttgctgttgtctcagaattgttgc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883683 |
ctacgtatgattattactctttacagataaaaaataactagaaa-taccaaaatcatataaatttgtaagaatattttgctgttgtctcagaattgttgc |
8883781 |
T |
 |
| Q |
123 |
atcatttactaactcattattttaattgcatcatacaatcagaagcatgttcttctaacactataaccgtgcaaaacattggacactgattccctgcatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883782 |
atcatttactaactcattattttaattgcatcatacaatcagaagcatgttcttctaacactataaccgtgcaaaacattggacactgattccctgcatt |
8883881 |
T |
 |
| Q |
223 |
gaaaaaagaacgaggttacacgcagatttccatctcgatggtaaatacaagatcaaatggttcagattacacaataacaaaatccgtttagcacgaagtt |
322 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883882 |
gaaaaaagaacgcggttacacgcagatttccatcacgatggtaaatatgagatcagatggttcagattacacaataacaaaatccgtttagcacgaagtt |
8883981 |
T |
 |
| Q |
323 |
aatttgagatcggccgacttgaatattgtgtattgcaattactgcaattaatccaaatctcacaactttggatatatccatagaatttac |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883982 |
aatttgagatcggccgacttgaatattgtgtattgcaattaccacacttaatccaaatctcacaactttggatatatccatagaatttac |
8884071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University