View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_20 (Length: 345)
Name: NF18668_low_20
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 36842465 - 36842791
Alignment:
| Q |
1 |
cttttactagaaattcaattttgtgagcaggatgagcaacaggaacaagaaaatgttcatcccataaagggttttcgcaattcggaatgactcttgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36842465 |
cttttactagaaattcaattttgtgagcaggatgagcaacaggaacaagaaaatgttcatcccataaagggttttcgcaattcggaatgactcttgtttg |
36842564 |
T |
|
| Q |
101 |
tgctatggttgcaccagctagacaaatagatacataagggtcacttgttatgatcttgtcttttcctgagtgtgttttgagtccttttacaaaaggtggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36842565 |
tgctatggttgcaccagctagacaaatagatacataagggtcacttgttatgatcttgtcttttcctgagtgggttttgagtccttttacaaaaggtggt |
36842664 |
T |
|
| Q |
201 |
gtgcaactatttcccatagttagacattttctaattgcttcagttgataaatctagatttggaagagattttgcttctatgataaatagatctaagtcac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36842665 |
gtgcaactatttcccatagttagacattttctaattgcttcagttgataaatctagatttggaagagattttgcttctatgataaatagatctaagtcac |
36842764 |
T |
|
| Q |
301 |
catgtaagaaaactggatactcattac |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36842765 |
catgtaagaaaactggatactcattac |
36842791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University