View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_24 (Length: 337)
Name: NF18668_low_24
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 81 - 329
Target Start/End: Original strand, 36996623 - 36996871
Alignment:
| Q |
81 |
agtgtcttgggaggaggacgagaaagctctcaggtaatatgtgcttttggtatcccaacatttctttctttatatcctccaattcactgtctttccatat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36996623 |
agtgtcttgggaggaggacgagaaagctctcaggtaatatgtgcttttggtatcccaacatttctttctttatatcctccaattcactgtctttccatat |
36996722 |
T |
 |
| Q |
181 |
ggagaatattttagtgtgttttcatgtattacttaattgcatctaaaacgtaggtgtatatactgatggatcgacagagcaatgcaacaacaatgaacca |
280 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36996723 |
ggagaatattttagcgtgttttcatgtattacttaattgcatctaaaacgtaggtgtatatactgatggatcgacagagcaatgcaacaacaatgaacca |
36996822 |
T |
 |
| Q |
281 |
ttcaattcatgggataatggaagtgtttgtgatggtgagtatgatgatg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36996823 |
ttcaattcatgggataatggaagtgtttgtgatggtgagtatgatgatg |
36996871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University