View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_27 (Length: 327)
Name: NF18668_low_27
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_27 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 9 - 327
Target Start/End: Original strand, 36605795 - 36606113
Alignment:
| Q |
9 |
gacatcatcaaaagctgggggaagatggccagaagcaggcctttctgttgctagattctgtaaaaccattcccttctcttcttctaaaactttctggctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605795 |
gacatcatcaaaagctgggggaagatggccagaagcaggcctttctgttgctagattctgtaaaaccattcccttctcttcttctaaaactttctggctt |
36605894 |
T |
|
| Q |
109 |
gaaattttagtagatatattcagaggtgcaatttcagccactgaggacactctttccctcaccatgaacttgtcatcaccagttgagatgtacataagct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605895 |
gaaattttagtagatatattcagaggtgcaatttcagccactgaggacactctttccctcaccatgaacttgtcatcaccagttgagatgtacataagct |
36605994 |
T |
|
| Q |
209 |
ttggctggctaactttatgaggcctattagttggcaagcttgctggactaacttcacaaacagacttttttccagaaatggaaagtgaatgtttgagaga |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605995 |
ttggctggctaactttatgaggcctattatttggcaagcttactggactaacttcacaaacagacttttttccagaaatggaaagtgaatgtttgagaga |
36606094 |
T |
|
| Q |
309 |
attgatcgaagccatttcc |
327 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
36606095 |
attgattgaagccatttcc |
36606113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University