View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_32 (Length: 293)
Name: NF18668_low_32
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 293
Target Start/End: Original strand, 25581369 - 25581652
Alignment:
| Q |
11 |
catagggaacaaaatatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccnnnnnnn-caa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25581369 |
catagggaacaaaatatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccttttttttcaa |
25581468 |
T |
|
| Q |
110 |
tgcttggaactacccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaattcaatccttcaatgacattttctatactat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25581469 |
tgcttggaactacccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaatttaatccttcaatgacattttctatactat |
25581568 |
T |
|
| Q |
210 |
acttcgtacagcacagcacatattatgactttcatgcctttcctctcattatacttgtgtatcatgattgtaacttataacagc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581569 |
acttcgtacagcacagcacatattatgactttcatgcctttcctctcattatacttgtgtatcatgattgtaacttataacagc |
25581652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 23 - 93
Target Start/End: Complemental strand, 42895471 - 42895401
Alignment:
| Q |
23 |
aatatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
93 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895471 |
aatatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
42895401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University