View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_40 (Length: 250)
Name: NF18668_low_40
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 40553865 - 40554081
Alignment:
| Q |
13 |
aatattccgttgaagcttggatatctttctgttgaattgtgtaaattggtgagcatttttgttgatgatgacaacacatgctctcgaattgaaggtgata |
112 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40553865 |
aatattccgctgaagctcggatatctttctgttgaattgtgtaaattggtgagcatttttgttgatgatgacaacacatgctctcgaattgaaggtgata |
40553964 |
T |
 |
| Q |
113 |
tcaatggtacactgtgtgaaattttgaaaacgcttagtcgcaaaaaacaagtttctgcttttgaatttgttcatagtggtattataggttcattagttaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40553965 |
tcaatggtacactgtgtgaaattttgaaaacgcttagttgcaaaaaacaagtttctgcttttgaatttgttcatagtggtattataggttcattagttaa |
40554064 |
T |
 |
| Q |
213 |
gtattcagttcatggcc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40554065 |
gtattcagttcatggcc |
40554081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University