View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_44 (Length: 237)
Name: NF18668_low_44
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 87 - 171
Target Start/End: Original strand, 34331018 - 34331102
Alignment:
| Q |
87 |
atgtaaaacaaatgagtataaccatgttattaggcgagttcatggagatttaactgggtaacatgattggtgttggaccaatttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331018 |
atgtaaaacaaatgagtataaccatgttattaggcgagttcatggagatttaactgggtaacatgattggtgttggaccaatttt |
34331102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Original strand, 34331450 - 34331501
Alignment:
| Q |
170 |
ttattaagaggattatactagatgacttccaaaattaaagttggagcaaagat |
222 |
Q |
| |
|
|||| ||||||| || | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34331450 |
ttatcaagaggactacaatagatgacttccaaa-ttaaagttggagcaaagat |
34331501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University