View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_47 (Length: 228)
Name: NF18668_low_47
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 26 - 139
Target Start/End: Original strand, 16005803 - 16005916
Alignment:
| Q |
26 |
aggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatattttttccatgactttactttagtttctttcccg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16005803 |
aggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatatttttgccatgactttactttagtttctttccca |
16005902 |
T |
 |
| Q |
126 |
agagatatttgtgc |
139 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16005903 |
agagatatttgtgc |
16005916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University