View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18668_low_48 (Length: 218)
Name: NF18668_low_48
Description: NF18668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18668_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 29641278 - 29641468
Alignment:
| Q |
16 |
aatatcccataagttaaaaaccaataccacaataagacgcaaaatcaaacaatgccacataaacatagttgatgacggtgtaaaattcttttatattgtt |
115 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29641278 |
aataacccgtaagttaaaaaccaataccacaataagacgtaaaatcaaacaatgtcacataaacatagttgatgatggtgtaaaattcttttatattgtt |
29641377 |
T |
|
| Q |
116 |
ggtgtatatggattaaattatttaagagt-agcgtaagtgctaagatattctccatgtaatggcaaatgaaatacatgtcaacttttattt |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29641378 |
ggtgtatatagattaaattatttaagagtaaacttaagtgctaagatattctccatgtaatggcaaatgaaatacatgtcaacttttattt |
29641468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University