View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_high_25 (Length: 237)
Name: NF18669_high_25
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 22 - 126
Target Start/End: Complemental strand, 41921377 - 41921273
Alignment:
| Q |
22 |
aaacttacactgtgcgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagattgtga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41921377 |
aaacttacactgtgcgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagattgtga |
41921278 |
T |
 |
| Q |
122 |
agcat |
126 |
Q |
| |
|
||||| |
|
|
| T |
41921277 |
agcat |
41921273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 41921239 - 41921146
Alignment:
| Q |
124 |
catacattggcaggcatgatgatgatgattcttgactactgaggttaaatgttggaatatcctcaatatcttcttcatcgctctcaataccttcttc |
220 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
41921239 |
catacattggcagacatgatga---tgattcttgactactgatgttaaatgttggaatatcctcaatatcttcttcatcactctcaatatcttcttc |
41921146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 116
Target Start/End: Complemental strand, 1695464 - 1695370
Alignment:
| Q |
22 |
aaacttacactgtgcgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagat |
116 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| || || |||||||||||||||| ||||||||||||||| |
|
|
| T |
1695464 |
aaacttacactaaacgctcagttttcaggcggctagcatttttcatttttgataaacgattgattgtagcatttggatgtaatgcaactaaagat |
1695370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University