View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_high_27 (Length: 218)
Name: NF18669_high_27
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 30809531 - 30809730
Alignment:
| Q |
1 |
caaaagtaatttgttgttaggttgtattttttaattgtgaatcttgttgaatattatcttgctcctatcatatgtggatgcagatgctaaaatcaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809531 |
caaaagtaatttgttgttaggttgtattttttaattgtgaatcttgttgaatattatcttgctcctatcatatgtggatgcagatgctaaaatcaatttc |
30809630 |
T |
 |
| Q |
101 |
agctgggagctttgctaatgatggcgaaatcaataccgttgcaactgatcttttcttcatatacaccttatgtgcttatgacgtacaaggaaggctaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809631 |
agctgggagctttgctaatgatggcgaaatcaacaccgttgcaactgatcttttcttcatatacaccttatgtgcttatgacgtacaaggaaggctaaat |
30809730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University