View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_high_7 (Length: 410)
Name: NF18669_high_7
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_high_7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 294 - 410
Target Start/End: Original strand, 37502769 - 37502885
Alignment:
| Q |
294 |
tagcattcttgagactgcgacgtaggtggcagtgcaagcaagatacttgcttaatggttggtgtgctacacagcgcagactatgagacagaagcggaaac |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||| |
|
|
| T |
37502769 |
tagcattcttgagactgcgatgtaggtggcagtgcaagcaagatacttgcttaatggttggtgtgccacacagcgcagactatgaggcagaagcagaaac |
37502868 |
T |
|
| Q |
394 |
gagctgttgctccaatt |
410 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
37502869 |
gagctgttactccaatt |
37502885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University