View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_low_15 (Length: 322)
Name: NF18669_low_15
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 14 - 322
Target Start/End: Complemental strand, 37503148 - 37502840
Alignment:
| Q |
14 |
aatatcaactaccttcttgactcaaaatccacattttccatttgatgctcatggctccacttgattgttcacaatgatccacatggttctccttcgtcca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37503148 |
aatatcaactaccttcttgactcaaaatccacattttccatttgatggtcatggctccacttgattgctcacaatgatccacatggttctccttcgtcca |
37503049 |
T |
 |
| Q |
114 |
ccaaacaaatttggaaaaaacaattctgttttaacacgcacaaaaccactcgaatcatttctgatgcaggcaccaatgccttctccattactagcattgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503048 |
ccaaacaaatttggaaaaaacaattctgttttaacacgcacgaaaccactcgaatcatttctgatgcaggcaccaatgccttctccattactagcattgg |
37502949 |
T |
 |
| Q |
214 |
aaaatgaggcattgatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagcaacagctcgtttctgcttctgtctcata |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37502948 |
aaaatgaggcattgatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagtaacagctcgtttctgcttctgcctcata |
37502849 |
T |
 |
| Q |
314 |
gtctgcgct |
322 |
Q |
| |
|
||||||||| |
|
|
| T |
37502848 |
gtctgcgct |
37502840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University