View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_low_23 (Length: 266)
Name: NF18669_low_23
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 29908547 - 29908665
Alignment:
| Q |
16 |
attcaaaaaggctcattaaaccgcgaaaatttcaccaaatatgttacaaaagtcaaaccaccagcagatgaatatcaacggtctgctgaacaatctcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29908547 |
attcaaaaaggctcattaaaccgcgaaaatttcaccaaatatgttacaaaagtcaaaccaccagcagatgaatatcaatggtctgctgaacaatctcatt |
29908646 |
T |
|
| Q |
116 |
aacactggtaagattaagg |
134 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
29908647 |
aacattggtaagattaagg |
29908665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University