View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18669_low_33 (Length: 204)

Name: NF18669_low_33
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18669_low_33
NF18669_low_33
[»] chr2 (3 HSPs)
chr2 (20-145)||(13448428-13448553)
chr2 (20-145)||(13454899-13455024)
chr2 (20-145)||(13440265-13440390)
[»] chr5 (2 HSPs)
chr5 (21-139)||(12540751-12540869)
chr5 (24-136)||(28385403-28385515)
[»] chr7 (1 HSPs)
chr7 (20-145)||(3417516-3417641)
[»] scaffold0536 (1 HSPs)
scaffold0536 (56-145)||(6497-6589)
[»] chr6 (2 HSPs)
chr6 (27-110)||(12590196-12590279)
chr6 (33-109)||(12483492-12483568)
[»] chr4 (4 HSPs)
chr4 (23-145)||(48958212-48958337)
chr4 (23-145)||(48961361-48961486)
chr4 (27-145)||(48965401-48965519)
chr4 (27-145)||(48912331-48912452)
[»] chr8 (1 HSPs)
chr8 (23-109)||(12641506-12641592)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 13448428 - 13448553
Alignment:
20 ccccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatattt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
13448428 ccccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacctgtggggcccaacccctaatgatcaaacccttcttcccgatattt 13448527  T
120 ctctcttcaaatcccttcggtaacca 145  Q
    ||||||||||||||||||||||||||    
13448528 ctctcttcaaatcccttcggtaacca 13448553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 13454899 - 13455024
Alignment:
20 ccccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatattt 119  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||    
13454899 ccccccgcaatgcgtcataaatccccccactgcagggtgactcaatatcttaacttgtggggcccaacccctaatgatcaaaccctttttctcgatgttt 13454998  T
120 ctctcttcaaatcccttcggtaacca 145  Q
     ||||||||||||||||||| |||||    
13454999 ttctcttcaaatcccttcggcaacca 13455024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 13440265 - 13440390
Alignment:
20 ccccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatattt 119  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||  || |||    
13440265 ccccccgcaatgcgtcataaatccccccaccgcagggtggctcaatatcttaacttgtggggcccaacccttaatgatcaaacccatcctcctaatgttt 13440364  T
120 ctctcttcaaatcccttcggtaacca 145  Q
    |||||||| |||||||| || |||||    
13440365 ctctcttcgaatccctttggcaacca 13440390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 21 - 139
Target Start/End: Original strand, 12540751 - 12540869
Alignment:
21 cccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatatttc 120  Q
    ||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || || || ||||    
12540751 cccccacaatgtgtcataaatccccccaccgcagggtggctcaatatcttaacctgtggggcccaacccctaatgatcaaacccttttttccaatgtttc 12540850  T
121 tctcttcaaatcccttcgg 139  Q
    |||| ||||||||||||||    
12540851 tctcctcaaatcccttcgg 12540869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 24 - 136
Target Start/End: Original strand, 28385403 - 28385515
Alignment:
24 ccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatatttctct 123  Q
    |||||||| |||| |||||||||||| ||||||| ||||||||||  ||||||||||||||||||||| || || ||||||||||| || || |||||||    
28385403 ccgcaatgtgtcagaaatccccccaccgcagggttgctcaatatcagaacttgtggggcccaacccctgattatgaaacccttctttccaatgtttctct 28385502  T
124 cttcaaatccctt 136  Q
    | |||||||||||    
28385503 cctcaaatccctt 28385515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 145
Target Start/End: Complemental strand, 3417641 - 3417516
Alignment:
20 ccccccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatattt 119  Q
    |||||| ||||| |||||||||||||| || ||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| || || |||    
3417641 ccccccacaatgtgtcataaatccccctaccgcagggtggctcaatatctgaacctgtggggcccaacccctaacgatcaaacccttctttccaatgttt 3417542  T
120 ctctcttcaaatcccttcggtaacca 145  Q
    ||||| |||||||||||||| |||||    
3417541 ctctcctcaaatcccttcggcaacca 3417516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 56 - 145
Target Start/End: Complemental strand, 6589 - 6497
Alignment:
56 gtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttc---ccgatatttctctcttcaaatcccttcggtaacca 145  Q
    ||||||||| ||| |||||||||| |||||||||||||| |||||||||||||||   ||||||||||||||||| |||||||| || |||||    
6589 gtggctcaaaatcataacttgtggagcccaacccctaataatcaaacccttcttctttccgatatttctctcttcgaatccctttggcaacca 6497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 27 - 110
Target Start/End: Complemental strand, 12590279 - 12590196
Alignment:
27 caatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttc 110  Q
    ||||| ||||||||  | |||||||||  ||||||||  ||| | |||||||||||||||||||||||||||||||||||||||    
12590279 caatgtgtcataaacgcgcccactgcattgtggctcataatcattacttgtggggcccaacccctaatgatcaaacccttcttc 12590196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 12483568 - 12483492
Alignment:
33 gtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttctt 109  Q
    ||||||||| | |||||||||||||||||||| |||   || ||||| ||||| ||||| ||||| |||||| ||||    
12483568 gtcataaatgcacccactgcagggtggctcaaaatcagtacctgtggtgcccaccccctgatgattaaacccatctt 12483492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 145
Target Start/End: Original strand, 48958212 - 48958337
Alignment:
23 cccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacc---cttcttcccgatattt 119  Q
    ||||||||| ||||||||| | ||||| |||  ||||||||  |||  ||||||||||||||| |||||||||||||||||   |||||| || || |||    
48958212 cccgcaatgtgtcataaatgcacccacggcaatgtggctcagaatcaaaacttgtggggcccaccccctaatgatcaaacctttcttctttccaatgttt 48958311  T
120 ctctcttcaaatcccttcggtaacca 145  Q
    |||||||| ||||| ||||| |||||    
48958312 ctctcttcgaatcctttcggcaacca 48958337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 145
Target Start/End: Original strand, 48961361 - 48961486
Alignment:
23 cccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcc---cgatattt 119  Q
    ||||||||||||||||||  | ||||| || | ||||| ||  ||| |||||||||||||||| ||| ||||||||||||||||||||    | || |||    
48961361 cccgcaatgcgtcataaacacacccaccgctgtgtggcccaggatcataacttgtggggcccaccccttaatgatcaaacccttcttcttttcaatgttt 48961460  T
120 ctctcttcaaatcccttcggtaacca 145  Q
    |||||||||||||| ||||| |||||    
48961461 ctctcttcaaatcctttcggcaacca 48961486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 145
Target Start/End: Original strand, 48965401 - 48965519
Alignment:
27 caatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttcccgatatttctctctt 126  Q
    ||||| ||||||||  | ||||| || ||||||||||  |||  ||| || || |||||||||||||| |||||||||||||| || || ||||||||||    
48965401 caatgagtcataaaggcacccacagcggggtggctcagaatcagaacctgcggagcccaacccctaataatcaaacccttctttccaatgtttctctctt 48965500  T
127 caaatcccttcggtaacca 145  Q
    | |||||||| ||||||||    
48965501 cgaatccctttggtaacca 48965519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 48912452 - 48912331
Alignment:
27 caatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttcttc---ccgatatttctct 123  Q
    ||||| ||||||||| | ||||| || | ||||||||  ||| |||| ||||| ||||||||| |||| |||| | ||||||||   |||||| ||||||    
48912452 caatgtgtcataaatgcacccacggctgtgtggctcagaatcataacctgtggagcccaacccttaataatcatagccttcttctttccgataattctct 48912353  T
124 cttcaaatcccttcggtaacca 145  Q
    ||||||| ||||| || |||||    
48912352 cttcaaacccctttggcaacca 48912331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 12641592 - 12641506
Alignment:
23 cccgcaatgcgtcataaatccccccactgcagggtggctcaatatcttaacttgtggggcccaacccctaatgatcaaacccttctt 109  Q
    ||||||||||||||| ||| | ||||| |||| |||||| || ||| | ||||||||||||||  |||||||||| ||||| |||||    
12641592 cccgcaatgcgtcatgaatgcacccacagcagcgtggcttaaaatcattacttgtggggcccactccctaatgataaaacctttctt 12641506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University