View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18669_low_9 (Length: 405)
Name: NF18669_low_9
Description: NF18669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18669_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Original strand, 5957686 - 5958072
Alignment:
| Q |
1 |
tctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgccggagtttgcgcgagcacct |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957686 |
tctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgccggagtttgcgcgagcacct |
5957785 |
T |
 |
| Q |
101 |
ggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggaggatgagtttggggaggagattg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957786 |
ggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggaggatgagtttggggaggagattg |
5957885 |
T |
 |
| Q |
201 |
ttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatgaaggtgaagtttgatgatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957886 |
ttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatgaaggtgaagtttgatgatga |
5957985 |
T |
 |
| Q |
301 |
tgggaagatggggatggagattgttaaggaatgtgctgaggattctcttaggagtgatgaattgaatcttgctgttttgaaagaggt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957986 |
tgggaagatggggatggagattgttaaggaatgtgctgaggattctcttaggagtgatgaattgaatcttgctgttttgaaagaggt |
5958072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University