View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1866_high_12 (Length: 247)

Name: NF1866_high_12
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1866_high_12
NF1866_high_12
[»] chr6 (1 HSPs)
chr6 (103-184)||(32868886-32868967)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 103 - 184
Target Start/End: Original strand, 32868886 - 32868967
Alignment:
103 agatttgcgagtttcaaattttagcaaagcttgtttatctgatgctgattttgtgttgtgattgtgaccattaccgcaacaa 184  Q
    |||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||    
32868886 agatttgcgagtttcaaattatagcaaaccttgtttatctgatgcttattttgtgttgtgattgtgaccattaccgcaacaa 32868967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University