View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1866_high_15 (Length: 243)
Name: NF1866_high_15
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1866_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 45 - 193
Target Start/End: Original strand, 38284634 - 38284782
Alignment:
| Q |
45 |
gttgatttgttttgattctgttgagaaggcttttggattttgggggtggcttttaaggggtttgaactagtggtgtgtagtgttgtcgcttgcctcttga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38284634 |
gttgatttgttttgattctgttgagaaggcttttggattttgggggtggcttttaaggggtttgaactagtggtatgtagtgttgtcgcttgcctcttga |
38284733 |
T |
 |
| Q |
145 |
tagtgtgagtgctcaatttcagggagtgttcttacttcttagtaggggg |
193 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
38284734 |
tagtgtgagtgctcaatttccgggagtgttcttacttcatagtaggggg |
38284782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 52 - 178
Target Start/End: Original strand, 2221404 - 2221520
Alignment:
| Q |
52 |
tgttttgattctgttgagaaggcttttggattttgggggtggcttttaaggggtttgaactagtggtgtgtagtgttgtcgcttgcctcttgatagtgtg |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
2221404 |
tgttctgattctgttgagaaggcttttggattttgcgggtggcttttaaggggtttgaac----------tagtgttgttgcttgcctcttgacagtgtg |
2221493 |
T |
 |
| Q |
152 |
agtgctcaatttcagggagtgttctta |
178 |
Q |
| |
|
|||| |||||| ||||| ||||||||| |
|
|
| T |
2221494 |
agtgttcaattccagggtgtgttctta |
2221520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University