View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1866_low_10 (Length: 276)
Name: NF1866_low_10
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1866_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 30 - 205
Target Start/End: Original strand, 45479646 - 45479825
Alignment:
| Q |
30 |
aatactataaaataaaattgttttttagtttggtttgggtgataattaaaattattaagcaataaaatatagactttttggagtacaattttgtgctcga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45479646 |
aatactataaaataaaattgttttttagtttggtttgggtgataattaaaattattaagcaataaaatatagactttttggagtacaattttgtgctcga |
45479745 |
T |
|
| Q |
130 |
caaataattatatatga----ttttttctatttaagaaaagctatccgtaaatgaattaattatagttgtttgcaaactt |
205 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45479746 |
caaataattatatatgattttttttttttatttaagaaaagctatccgtaaatgaattaattatagttgtttgcaaactt |
45479825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 32202524 - 32202579
Alignment:
| Q |
221 |
caacacttgtgatcttggaacgtgaccaagagagaagaaaacggtagggtgcagat |
276 |
Q |
| |
|
||||||||| ||||||| ||| | |||||||| |||||||||||| |||||||||| |
|
|
| T |
32202524 |
caacacttgggatcttgtaactttaccaagagggaagaaaacggtggggtgcagat |
32202579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 40455122 - 40455068
Alignment:
| Q |
222 |
aacacttgtgatcttggaacgtgaccaagagagaagaaaacggtagggtgcagat |
276 |
Q |
| |
|
|||||||| ||||||| ||| | |||||||| |||||||||||| |||||||||| |
|
|
| T |
40455122 |
aacacttgggatcttgtaactttaccaagagggaagaaaacggtggggtgcagat |
40455068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University