View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1866_low_15 (Length: 246)
Name: NF1866_low_15
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1866_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 117 - 230
Target Start/End: Complemental strand, 10182380 - 10182267
Alignment:
| Q |
117 |
gcatttcatagccaatacaccattttattgccttcatatacaatacattttccattccaaatattacaccatatgtaactcggttcaaaccaagataatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10182380 |
gcatttcatagccaatacaccattttattgccttgatgtacaatacattttccattccaaatattacaccatatgtaactcggttcaaaccaagataatt |
10182281 |
T |
|
| Q |
217 |
aattactttgagaa |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10182280 |
aattactttgagaa |
10182267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 10182460 - 10182391
Alignment:
| Q |
6 |
caatttttactatcagacaacataatattagtaatactcaattgatccaaaccaaaatcatcattgatag |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
10182460 |
caatttttactatcagacaacataatattagcaacagtcaattgatccaaaccaaaatcatcattgatag |
10182391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University